Positive T3REs
This list of naturally occurring elements is divided according to architecture. Matches to the hexameric consensus AGGTCA are indicated in bold type, and numbers flanking the elements refer to position relative to transcriptional start site. Composite elements that fit more than one such category appear in all appropriate categories. References to relevant papers are included. At this stage only a small subset of known response elements is included. Suggestions for including additional well characterized T3REs are welcome.
|
DR-4
The DR-4 sites in the rat growth hormone, rat malic enzyme and rat myosin heavy chain alpha promoters are among the best characterized naturally occurring T3REs.
Rat Growth Hormone Promoter
-190 AAGGTAAGATCAGGGACGTGACCGC -166
The rat growth hormone element was the first T3RE to be characterized in detail. Initial confusion about whether it was a DR or IR type site was followed by the realization that it is a composite element with contributions from three hexameric motifs. Two points about this T3RE are worth mentioning: 1) The wild type version is relatively weak compared to other wild type and synthetic T3REs, and its potency can be improved substantially by mutations that increase matches to the AGGTCA consensus. 2) While some lines of evidence support the description of this site as a combined DR-4 and IR-1, other evidence is consistent with a DR-5, IR-0 arrangement.
R. J. Koenig, G. A. Brent, R. L. Warne, P. R. Larsen & D. D. Moore. Thyroid hormone receptor binds to a site in the rat growth hormone promoter required for induction by thyroid hormone. Proc Natl Acad Sci U S A 84: 5670-4 (1987)[87289666]
First report - it's a direct repeat
C. K. Glass, R. Franco, C. Weinberger, V. R. Albert, R. M. Evans & M. G. Rosenfeld. A c-erb-A binding site in rat growth hormone gene mediates trans-activation by thyroid hormone. Nature 329: 738-41 (1987)[88039052]
Contemporary description - it's a palidrome
G. A. Brent, J. W. Harney, Y. Chen, R. L. Warne, D. D. Moore & P. R. Larsen. Mutations of the rat growth hormone promoter which increase and decrease response to thyroid hormone define a consensus thyroid hormone response element. Mol Endocrinol 3: 1996-2004 (1989)[90190658]
No, it's both
Rat Malic Enzyme
-287 AGGACGTTGGGGTTAGGGGAGGACAGTG -260
K. J. Petty, B. Desvergne, T. Mitsuhashi & V. M. Nikodem. Identification of a thyroid hormone response element in the malic enzyme gene. J Biol Chem 265: 7395-400 (1990)[90237036]
Initial description
B. Desvergne, K. J. Petty & V. M. Nikodem. Functional characterization and receptor binding studies of the malic enzyme thyroid hormone response element. J Biol Chem 266: 1008-13 (1991)[91093205]
Mutagenesis
G. A. Brent, G. R. Williams, J. W. Harney, B. M. Forman, H. H. Samuels, D. D. Moore & P. R. Larsen. Capacity for cooperative binding of thyroid hormone (T3) receptor dimers defines wild type T3 response elements. Mol Endocrinol 6: 502-14 (1992)[92261605]
Further mutagenesis
Rat Cardiac Myosin Heavy Chain Alpha
-160 CTGGAGGTGACAGGAGGACAGCAGCCCTGA -131
S. Izumo & V. Mahdavi Thyroid hormone receptor alpha isoforms generated by alternative splicing differentially activate myosin HC gene transcription. Nature 334: 539-42 (1988)[88302448] [published cDNA sequence erratum appears in Nature 1988 Oct 20;335(6192):744]
Initial description
G. A. Brent, G. R. Williams, J. W. Harney, B. M. Forman, H. H. Samuels, D. D. Moore & P. R. Larsen. Capacity for cooperative binding of thyroid hormone (T3) receptor dimers defines wild type T3 response elements. Mol Endocrinol 6: 502-14 (1992)[92261605]
Mutagenesis
Back to the top
ER-6
The first ER-6 T3RE was initially identified as a negative regulatory element or silencer upstream of the chicken lysozyme silencer gene. This identification is consistent with the direct repressor activity exhibited by the TRs in the absence of hormone. ER-6 sites are unusual in that they bind TR homodimers with particularly high affinity. This high affinity binding is disrupted in the presence of T3, however.
Chicken Lysozyme Silencer
-2354 TTATTGACCCCAGCTGAGGTCAAGTTACG -2326
A. Baniahmad, C. Steiner, A. C. Kohne & R. Renkawitz. Modular structure of a chicken lysozyme silencer: involvement of an unusual thyroid hormone receptor binding site. Cell 61: 505-14 (1990)[90242396]
initial description
Myelin Basic Protein
-186 AGACCTCGGCTGAGGACACGGCGG -163
A. Farsetti, B. Desvergne, P. Hallenbeck, J. Robbins & V. M. Nikodem. Characterization of myelin basic protein thyroid hormone response element and its function in the context of native and heterologous promoter. J Biol Chem 267: 15784-8 (1992)[92348442]
Back to the top
Monomer
TAAGGTCA
This synthetic element was identified as a high affinity binding site for TRalpha monomers by direct selection from random sequences. That this putative T3RE actually functions as a response element by interacting with monomeric TR was confirmed by the ability of mutant TRs unable to dimerize with RXR to activate the octameric site, but not appropriate TR/RXR heterodimer binding sites.
R. W. Katz & R. J. Koenig Specificity and mechanism of thyroid hormone induction from an octamer response element. J Biol Chem 269: 18915-18920 (1994)[94308150]
Confirmation of original descriptions of monomer elements
Back to the top
Composite
Many wild type hormone elements include several potential matches to the hexameric consensus that may function to interact with multiple receptor complexes. In some cases, however, more than two such matches clearly contribute to T3 response.
Rat Growth Hormone: promoter
-190 AAGGTAAGATCAGGGACGTGACCGC -166
This rat growth hormone promoter element was the first T3RE to be characterized in detail. Initial confusion about whether it was a DR or IR type site was followed by the realization that it is a composite element with contributions from three hexameric motifs. Two points about this T3RE deserve mention: 1) The wild type version is relatively weak compared to other wild type and synthetic T3REs, and its potency can be improved substantially by mutations that increase matches to the AGGTCA consensus. 2) While some lines of evidence support the description of this site as a combined DR-4 and IR-1, other evidence is consistent with a DR-5, IR-0 arrangement.
R. J. Koenig, G. A. Brent, R. L. Warne, P. R. Larsen & D. D. Moore. Thyroid hormone receptor binds to a site in the rat growth hormone promoter required for induction by thyroid hormone. Proc Natl Acad Sci U S A 84: 5670-4 (1987)[87289666]
First report - it's a direct repeat
C. K. Glass, R. Franco, C. Weinberger, V. R. Albert, R. M. Evans & M. G. Rosenfeld. A c-erb-A binding site in rat growth hormone gene mediates trans-activation by thyroid hormone. Nature 329: 738-41 (1987)[88039052]
Contemporary description - it's a palidrome
G. A. Brent, J. W. Harney, Y. Chen, R. L. Warne, D. D. Moore & P. R. Larsen. Mutations of the rat growth hormone promoter which increase and decrease response to thyroid hormone define a consensus thyroid hormone response element. Mol Endocrinol 3: 1996-2004 (1989)[90190658]
No, it's both
Rat Growth Hormone: 3rd intron
+1342 GAGGCTGAGGTAACTTGGGAGTCCCAGGCAGAGGTCACTA +1381
This T3RE from within the third intron of the rGH gene is considerably more potent than the promoter element. The analysis of this element leaves its underlying architecture unclear. Though the perfect match to the AGGTCA consensus appears to be the strongest contact site by methylation interference, a number of additional contacts are also observed. The matches to the hexameric consensus indicated are thus speculative.
J. Sap, L. de Magistris, H. Stunnenberg & B. Vennstrom. A major thyroid hormone response element in the third intron of the rat growth hormone gene. EMBO J 9: 887-96 (1990)[90183989]
Back to the top
Back to the TRR Home Page